circad | circRNAs associated with diseases

Hsa_circ_0046264
Gene		Organism	Human
Genome Locus		Build	hg19
Disease	Lung Cancer	ICD-10	Malignant neoplasm of bronchus and lung (C34)
DBLink		PMID	29891014
Experimental Method
Sample Type	Tissue and cell lines	Comparison	99 lung cancer tissue specimens, containing 23-paired specimens
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward CGACAAAGATGGGGTTGTCC Reverse CCAACCTGATCTCGGAACCT	Statistics	Fold Change : Downregulated pvalue : <0.05
Citation
Yang, L, Wang, J, Fan, Y, Yu, K, Jiao, B, Su, X (2018). Hsa_circ_0046264 up-regulated BRCA2 to suppress lung cancer through targeting hsa-miR-1245. Respir. Res., 19, 1:115.